m.8348A>G

Resolving variant against ClinVar, gnomAD and Ensembl…

Viewing single variant in MT-TK

Full MT-TK gene page

Benign / Likely Benign

MT-TK:m.8348A>G

Nomenclaturem.8348A>GchrMT:8348|ClinVar #690079

Typemitochondrial tRNA variant

InheritanceMitochondrial

gnomAD mtDNA

53 hom · 9 het

of 56,431 genomes

MitoTIP

10.3 · Q3 possibly benign

PON-mt-tRNA

0.23 · neutral

ClinVarBenign/Likely benign

Review: criteria provided, multiple submitters, no conflictsSubmitters: 2view ↗Last evaluated: 2019/07/12 00:00

MELAS syndrome[OMIM][MedGen][Orphanet][MONDO]

not provided[MedGen]

MITOMAPReported

Disease: Cardiomyopathy · Sensorineural hearing loss (SNHL) · Poss. hypertension factorReported as: homoplasmic and heteroplasmicGenBank: 148 sequences

MITOMAP (mitomap.org), CC BY 3.0 · disease table as of 2026-10-07

Where it sits in the mitochondrial genome

Tap or hover a gene, landmark or tick; genes open their page, ticks their variant.

proteinrRNAtRNAouter ring H-strand · inner L-strandMITOMAP confirmedreported (as of 2026-10-07)

||||

GTTAAAGATTAAGAGAACCAACACCTCTTTACAGTGAAATG

G

MT-TK · ends m.8364

MT-ATP8 · starts m.8366

m.8328–8368 of the revised Cambridge Reference Sequence (NC_012920.1); the boxed base is m.8348 A→G.

37 genes from Ensembl (rCRS numbering, matched to MITOMAP’s Gene Loci); landmarks and disease alleles from MITOMAP (CC BY 3.0). Circular layout after MitoWheel.

Open Research Assistant for MT-TK →

External Resources

Franklin (Genoox)

AI-powered curation

mtDNA variant database · expect a security check

Variant interpretation · expect a security check

Gene & phenotype

mtDNA frequencies (v3.1)