Viewing single variant in MT-RNR1

Uncertain Significance (VUS)Not in ClinVar or MITOMAP — mtDNA classification needs case-level review

MT-RNR1:m.1537C>T

Tutor Research

Nomenclaturem.1537C>TchrMT:1537|Not in ClinVar

Typemitochondrial rRNA variant

InheritanceMitochondrial

gnomAD mtDNA

16 hom · 0 het

of 56,433 genomes

Aminoglycosides: uncertain-risk MT-RNR1 variant (CPIC)

Weak or no evidence of increased risk: standard doses for the shortest feasible course with drug-level monitoring, and regular hearing checks. CPIC: optional recommendation · CPIC guideline, McDermott et al. 2022 (PMID 34032273)

Tutor Research

MITOMAPReported

Live entry

Disease: Maternally inherited or aminoglycoside-induced deafness (DEAF) · Intellectual disabilityReported as: homoplasmicGenBank: 10 sequences

MITOMAP (mitomap.org), CC BY 3.0 · disease table as of 2026-10-07

Where it sits in the mitochondrial genome

Tap or hover a gene, landmark or tick; genes open their page, ticks their variant.

proteinrRNAtRNAouter ring H-strand · inner L-strandMITOMAP confirmedreported (as of 2026-10-07)

||||

ACATTTAACTAAAACCCCTACGCATTTATATAGAGGAGACA

MT-RNR1

m.1517–1557 of the revised Cambridge Reference Sequence (NC_012920.1); the boxed base is m.1537 C→T.

37 genes from Ensembl (rCRS numbering, matched to MITOMAP’s Gene Loci); landmarks and disease alleles from MITOMAP (CC BY 3.0). Circular layout after MitoWheel.