Viewing single variant in CYTB

Uncertain Significance (VUS)Not in ClinVar or MITOMAP — mtDNA classification needs case-level review

CYTB:m.16270C>T

Tutor Research

Nomenclaturem.16270C>TchrMT:16270|Not in ClinVar

Typemitochondrial control region variant

gnomAD mtDNA

4,980 hom · 19 het

of 56,361 genomes

Tutor Research

MITOMAPReported

Live entry

Disease: Melanoma patients · PCOS patientsGenBank: 3,234 sequences

MITOMAP (mitomap.org), CC BY 3.0 · disease table as of 2026-10-07

Where it sits in the mitochondrial genome

Tap or hover a gene, landmark or tick; genes open their page, ticks their variant.

proteinrRNAtRNAouter ring H-strand · inner L-strandMITOMAP confirmedreported (as of 2026-10-07)

|||||

CCAAAGCCACCCCTCACCCACTAGGATACCAACAAACCTAC

m.16250–16290 of the revised Cambridge Reference Sequence (NC_012920.1); the boxed base is m.16270 C→T.

37 genes from Ensembl (rCRS numbering, matched to MITOMAP’s Gene Loci); landmarks and disease alleles from MITOMAP (CC BY 3.0). Circular layout after MitoWheel.

Open Research Assistant for CYTB →

External Resources

Franklin (Genoox)

AI-powered curation

MITOMAP

mtDNA variant database · expect a security check

VarSome

Variant interpretation · expect a security check

OMIM

Gene & phenotype

gnomAD

mtDNA frequencies (v3.1)

UCSC Browser

Genome browser

m.16270C>T

Resolving variant against ClinVar, gnomAD and Ensembl…

CYTB:m.16270C>T

Where it sits in the mitochondrial genome

Lollipop Plot — Protein Context & Regional Constraint

Population Allele Frequencies

External Resources

CYTB:m.16270C>T

Where it sits in the mitochondrial genome

Lollipop Plot — Protein Context & Regional Constraint

Population Allele Frequencies

External Resources