Viewing single variant in MT-CO1

Uncertain Significance (VUS)Not in ClinVar or MITOMAP — mtDNA classification needs case-level review

MT-CO1:m.5906G>A (p.Met1=)

Tutor Research

Nomenclaturem.5906G>Ap.Met1=chrMT:5906|Not in ClinVar

TypeSynonymous

InheritanceMitochondrial

gnomAD mtDNA

Absent

of 56,433 genomes

ESM1b

-6.34

Tutor Research

MITOMAPReported

Live entry

Disease: Mitochondrial encephalomyopathy, lactic acidosis and stroke-like episodes (MELAS) · Leigh overlap SyndromeReported as: heteroplasmicGenBank: 0 sequences

MITOMAP (mitomap.org), CC BY 3.0 · disease table as of 2026-10-07

Where it sits in the mitochondrial genome

Tap or hover a gene, landmark or tick; genes open their page, ticks their variant.

proteinrRNAtRNAouter ring H-strand · inner L-strandMITOMAP confirmedreported (as of 2026-10-07)

||||

TTTACCTCACCCCCACTGATGTTCGCCGACCGTTGACTATT

MT-TY (L-strand) · ends m.5891

MT-CO1 · starts m.5904

m.5886–5926 of the revised Cambridge Reference Sequence (NC_012920.1); the boxed base is m.5906 G→A.

37 genes from Ensembl (rCRS numbering, matched to MITOMAP’s Gene Loci); landmarks and disease alleles from MITOMAP (CC BY 3.0). Circular layout after MitoWheel.