MT-RNR1:m.827A>G

Tutor Research

Nomenclaturem.827A>GchrMT:827|ClinVar #9634

Typemitochondrial rRNA variant

InheritanceMitochondrial

gnomAD mtDNA

1,309 hom · 4 het

of 56,404 genomes

Aminoglycosides: normal-risk MT-RNR1 variant (CPIC)

Aminoglycosides at standard doses for the shortest feasible course with drug-level monitoring; hearing loss is still possible, especially with high levels or long courses. CPIC: strong recommendation · CPIC guideline, McDermott et al. 2022 (PMID 34032273)

Tutor Research

ClinVarUncertain significance; drug response

VCV000009634

Review: criteria provided, multiple submitters, no conflictsSubmitters: 4view ↗Last evaluated: 2024/06/14 00:00

Mitochondrial non-syndromic sensorineural hearing loss[OMIM][MedGen][Orphanet][MONDO]

Gentamicin response[MedGen]

MITOMAPConflicting reports

Live entry

Disease: Maternally inherited or aminoglycoside-induced deafness (DEAF)Reported as: homoplasmicGenBank: 1,730 sequences

MITOMAP (mitomap.org), CC BY 3.0 · disease table as of 2026-10-07

Where it sits in the mitochondrial genome

Tap or hover a gene, landmark or tick; genes open their page, ticks their variant.

proteinrRNAtRNAouter ring H-strand · inner L-strandMITOMAP confirmedreported (as of 2026-10-07)

||||

ACGGGAAACAGCAGTGATTAACCTTTAGCAATAAACGAAAG

MT-RNR1

m.807–847 of the revised Cambridge Reference Sequence (NC_012920.1); the boxed base is m.827 A→G.

37 genes from Ensembl (rCRS numbering, matched to MITOMAP’s Gene Loci); landmarks and disease alleles from MITOMAP (CC BY 3.0). Circular layout after MitoWheel.