MT-TS1:m.7453G>A

Tutor Research

Nomenclaturem.7453G>AchrMT:7453|ClinVar #869395

Typemitochondrial tRNA variant

InheritanceMitochondrial

gnomAD mtDNA

0 hom · 2 het

of 56,427 genomes

MitoTIP

15.2 · Q2 possibly pathogenic

PON-mt-tRNA

0.77 · pathogenic

Tutor Research

ClinVarLikely pathogenic

VCV000869395

Review: reviewed by expert panelSubmitters: 3view ↗Last evaluated: 2024/10/28 00:00

Mitochondrial disease[MedGen][Orphanet][MONDO]

MITOMAPLikely pathogenicconfirmed

Live entry

Disease: Fatal neonatal lactic acidosis · Neonatal lactic acidosis, exercise intolerance, mild IDReported as: homoplasmic and heteroplasmicGenBank: 0 sequences

MITOMAP (mitomap.org), CC BY 3.0 · disease table as of 2026-10-07

Where it sits in the mitochondrial genome

Tap or hover a gene, landmark or tick; genes open their page, ticks their variant.

proteinrRNAtRNAouter ring H-strand · inner L-strandMITOMAP confirmedreported (as of 2026-10-07)

||||

CATAAAATCTAGACAAAAAAGGAAGGAATCGAACCCCCCAA

MT-CO1 · ends m.7445

MT-TS1 (L-strand) · starts m.7446

m.7433–7473 of the revised Cambridge Reference Sequence (NC_012920.1); the boxed base is m.7453 G→A.

37 genes from Ensembl (rCRS numbering, matched to MITOMAP’s Gene Loci); landmarks and disease alleles from MITOMAP (CC BY 3.0). Circular layout after MitoWheel.