m.4316A>G

Resolving variant against ClinVar, gnomAD and Ensembl…

Viewing single variant in MT-TI

Full MT-TI gene page

Conflicting Interpretations

MT-TI:m.4316A>G

Nomenclaturem.4316A>GchrMT:4316|ClinVar #235014

Typemitochondrial tRNA variant

InheritanceMitochondrial

gnomAD mtDNA

22 hom · 3 het

of 56,429 genomes

MitoTIP

11.1 · Q3 possibly benign

PON-mt-tRNA

0.69 · pathogenic

ClinVarConflicting classifications of pathogenicity

Review: criteria provided, conflicting classificationsSubmitters: 2view ↗Last evaluated: 2019/07/12 00:00

not provided[MedGen]

MELAS syndrome[OMIM][MedGen][Orphanet][MONDO]

MITOMAPReported

Disease: Hypertrophic cardiomyopathy (HCM) with hearing loss · Poss. hypertension factorReported as: homoplasmic and heteroplasmicGenBank: 36 sequences

MITOMAP (mitomap.org), CC BY 3.0 · disease table as of 2026-10-07

Where it sits in the mitochondrial genome

Tap or hover a gene, landmark or tick; genes open their page, ticks their variant.

proteinrRNAtRNAouter ring H-strand · inner L-strandMITOMAP confirmedreported (as of 2026-10-07)

||||

GAGTAAATAATAGGAGCTTAAACCCCCTTATTTCTAGGACT

G

MT-TI · ends m.4331

MT-TQ (L-strand) · starts m.4329

m.4296–4336 of the revised Cambridge Reference Sequence (NC_012920.1); the boxed base is m.4316 A→G.

37 genes from Ensembl (rCRS numbering, matched to MITOMAP’s Gene Loci); landmarks and disease alleles from MITOMAP (CC BY 3.0). Circular layout after MitoWheel.

Open Research Assistant for MT-TI →

External Resources

Franklin (Genoox)

AI-powered curation

mtDNA variant database · expect a security check

Variant interpretation · expect a security check

Gene & phenotype

mtDNA frequencies (v3.1)