Disease: Mitochondrial encephalomyopathy, lactic acidosis and stroke-like episodes (MELAS)Reported as: homoplasmic and heteroplasmicGenBank: 3 sequences

MITOMAP (mitomap.org), CC BY 3.0 · disease table as of 2026-10-07

Where it sits in the mitochondrial genome

Tap or hover a gene, landmark or tick; genes open their page, ticks their variant.

proteinrRNAtRNAouter ring H-strand · inner L-strandMITOMAP confirmedreported (as of 2026-10-07)

|||||

AAAGCACCCAACTTACACTTAGGAGATTTCAACTTAACTTG

MT-TV

m.1620–1660 of the revised Cambridge Reference Sequence (NC_012920.1); the boxed base is m.1640 A→G.

37 genes from Ensembl (rCRS numbering, matched to MITOMAP’s Gene Loci); landmarks and disease alleles from MITOMAP (CC BY 3.0). Circular layout after MitoWheel.