Viewing single variant in CYTB

Uncertain Significance (VUS)Not in ClinVar or MITOMAP — mtDNA classification needs case-level review

CYTB:m.16298T>C

Tutor Research

Nomenclaturem.16298T>CchrMT:16298|Not in ClinVar

Typemitochondrial control region variant

gnomAD mtDNA

2,812 hom · 11 het

of 56,415 genomes

Tutor Research

MITOMAPReported

Live entry

Disease: Protective factor for stroke risk (hg V)GenBank: 4,291 sequences

MITOMAP (mitomap.org), CC BY 3.0 · disease table as of 2026-10-07

Where it sits in the mitochondrial genome

Tap or hover a gene, landmark or tick; genes open their page, ticks their variant.

proteinrRNAtRNAouter ring H-strand · inner L-strandMITOMAP confirmedreported (as of 2026-10-07)

||||

CCAACAAACCTACCCACCCTTAACAGTACATAGTACATAAA

m.16278–16318 of the revised Cambridge Reference Sequence (NC_012920.1); the boxed base is m.16298 T→C.

37 genes from Ensembl (rCRS numbering, matched to MITOMAP’s Gene Loci); landmarks and disease alleles from MITOMAP (CC BY 3.0). Circular layout after MitoWheel.

Open Research Assistant for CYTB →

External Resources

Franklin (Genoox)

AI-powered curation

MITOMAP

mtDNA variant database · expect a security check

VarSome

Variant interpretation · expect a security check

OMIM

Gene & phenotype

gnomAD

mtDNA frequencies (v3.1)

UCSC Browser

Genome browser

m.16298T>C

Resolving variant against ClinVar, gnomAD and Ensembl…

CYTB:m.16298T>C

Where it sits in the mitochondrial genome

Lollipop Plot — Protein Context & Regional Constraint

Population Allele Frequencies

External Resources

CYTB:m.16298T>C

Where it sits in the mitochondrial genome

Lollipop Plot — Protein Context & Regional Constraint

Population Allele Frequencies

External Resources