m.5802T>C

Resolving variant against ClinVar, gnomAD and Ensembl…

Viewing single variant in MT-TC

Full MT-TC gene page

Uncertain Significance (VUS)

MT-TC:m.5802T>C

Nomenclaturem.5802T>CchrMT:5802|ClinVar #689996

Typemitochondrial tRNA variant

InheritanceMitochondrial

gnomAD mtDNA

—

not loaded

MitoTIP

13.4 · Q2 possibly pathogenic

Some data sources returned errors (1) — other data may still be shown below

gnomad: gnomAD lookup failed: Error: gnomAD API error: 400

ClinVarUncertain significance

Review: criteria provided, single submitterSubmitters: 1view ↗Last evaluated: 2019/07/12 00:00

MELAS syndrome[OMIM][MedGen][Orphanet][MONDO]

MITOMAPReported

Disease: Maternally inherited or aminoglycoside-induced deafness (DEAF)1555 increased penetrance · Obesity riskReported as: homoplasmicGenBank: 8 sequences

MITOMAP (mitomap.org), CC BY 3.0 · disease table as of 2026-10-07

Where it sits in the mitochondrial genome

Tap or hover a gene, landmark or tick; genes open their page, ticks their variant.

proteinrRNAtRNAouter ring H-strand · inner L-strandMITOMAP confirmedreported (as of 2026-10-07)

||||

TGCTTCTTCGAATTTGCAATTCAATATGAAAATCACCTCGG

C

MT-TC (L-strand)

m.5782–5822 of the revised Cambridge Reference Sequence (NC_012920.1); the boxed base is m.5802 T→C.

37 genes from Ensembl (rCRS numbering, matched to MITOMAP’s Gene Loci); landmarks and disease alleles from MITOMAP (CC BY 3.0). Circular layout after MitoWheel.

Open Research Assistant for MT-TC →

External Resources

Franklin (Genoox)

AI-powered curation

mtDNA variant database · expect a security check

Variant interpretation · expect a security check

Gene & phenotype

mtDNA frequencies (v3.1)