Viewing single variant in MT-TH

Uncertain Significance (VUS)Not in ClinVar or MITOMAP — mtDNA classification needs case-level review

MT-TH:m.12197C>T

Tutor Research

Nomenclaturem.12197C>TchrMT:12197|Not in ClinVar

Typemitochondrial tRNA variant

InheritanceMitochondrial

gnomAD mtDNA

0 hom · 1 het

of 56,433 genomes

MitoTIP

14.6 · Q2 possibly pathogenic

PON-mt-tRNA

0.62 · likely pathogenic

Tutor Research

MITOMAPReported

Live entry

Disease: Congenital sideroblastic anemia (CSA) +sensorineural hearing loss (SNHL) +motor delayReported as: homoplasmic and heteroplasmicGenBank: 0 sequences

MITOMAP (mitomap.org), CC BY 3.0 · disease table as of 2026-10-07

Where it sits in the mitochondrial genome

Tap or hover a gene, landmark or tick; genes open their page, ticks their variant.

proteinrRNAtRNAouter ring H-strand · inner L-strandMITOMAP confirmedreported (as of 2026-10-07)

||||

ACAACAGAGGCTTACGACCCCTTATTTACCGAGAAAGCTCA

MT-TH · ends m.12206

MT-TS2 · starts m.12207

m.12177–12217 of the revised Cambridge Reference Sequence (NC_012920.1); the boxed base is m.12197 C→T.

37 genes from Ensembl (rCRS numbering, matched to MITOMAP’s Gene Loci); landmarks and disease alleles from MITOMAP (CC BY 3.0). Circular layout after MitoWheel.