Viewing single variant in MT-TA

Uncertain Significance (VUS)Not in ClinVar or MITOMAP — mtDNA classification needs case-level review

MT-TA:m.5587T>C

Tutor Research

Nomenclaturem.5587T>CchrMT:5587|Not in ClinVar

Typemitochondrial tRNA variant

InheritanceMitochondrial

gnomAD mtDNA

7 hom · 1 het

of 56,431 genomes

MitoTIP

4.4 · Q4 likely benign

PON-mt-tRNA

0.32 · likely neutral

Tutor Research

MITOMAPReported

Live entry

Disease: Leber hereditary optic neuropathy (LHON) · Possible maternally inherited or aminoglycoside-induced deafness (DEAF) modifier · Maternally inherited diabetes and deafness (MIDD)

+3 more

· Dilated cardiomyopathy · Hypertension · Tic disorder

Reported as: homoplasmic and heteroplasmicGenBank: 39 sequences

MITOMAP (mitomap.org), CC BY 3.0 · disease table as of 2026-10-07

Where it sits in the mitochondrial genome

Tap or hover a gene, landmark or tick; genes open their page, ticks their variant.

proteinrRNAtRNAouter ring H-strand · inner L-strandMITOMAP confirmedreported (as of 2026-10-07)

||||

TACTTAATTTCTGTAACAGCTAAGGACTGCAAAACCCCACT

MT-TW · ends m.5579

MT-TA (L-strand) · starts m.5587

m.5567–5607 of the revised Cambridge Reference Sequence (NC_012920.1); the boxed base is m.5587 T→C.

37 genes from Ensembl (rCRS numbering, matched to MITOMAP’s Gene Loci); landmarks and disease alleles from MITOMAP (CC BY 3.0). Circular layout after MitoWheel.