MT-TL1:m.3243A>G

Tutor Research

Nomenclaturem.3243A>GchrMT:3243|ClinVar #9589

Typemitochondrial tRNA variant

InheritanceMitochondrial

gnomAD mtDNA

0 hom · 6 het

of 56,383 genomes

MitoTIP

13.3 · Q2 possibly pathogenic

PON-mt-tRNA

0.73 · likely pathogenic

Tutor Research

ClinVarPathogenic

VCV000009589

Review: reviewed by expert panelSubmitters: 52view ↗Last evaluated: 2020/08/20 00:00

Mitochondrial disease[MedGen][Orphanet][MONDO]

MITOMAPPathogenicconfirmed

Live entry

Disease: Mitochondrial encephalomyopathy, lactic acidosis and stroke-like episodes (MELAS) · Leigh Syndrome · Diabetes mellitus and deafness (DMDF)

+7 more

· Maternally inherited diabetes and deafness (MIDD) · Sensorineural hearing loss (SNHL) · Chronic progressive external ophthalmoplegia (CPEO) · Mitochondrial myopathy (MM) · Focal segmental glomerulosclerosis (FSGS) · ASD · Cardiac+multi-organ dysfunction

Reported as: heteroplasmicGenBank: 10 sequences

MITOMAP (mitomap.org), CC BY 3.0 · disease table as of 2026-10-07

Where it sits in the mitochondrial genome

Tap or hover a gene, landmark or tick; genes open their page, ticks their variant.

proteinrRNAtRNAouter ring H-strand · inner L-strandMITOMAP confirmedreported (as of 2026-10-07)

||||

AGGGTTTGTTAAGATGGCAGAGCCCGGTAATCGCATAAAAC

MT-RNR2 · ends m.3229

MT-TL1 · starts m.3230

m.3223–3263 of the revised Cambridge Reference Sequence (NC_012920.1); the boxed base is m.3243 A→G.

37 genes from Ensembl (rCRS numbering, matched to MITOMAP’s Gene Loci); landmarks and disease alleles from MITOMAP (CC BY 3.0). Circular layout after MitoWheel.