Viewing single variant in MT-CYB

Uncertain Significance (VUS)Not in ClinVar or MITOMAP — mtDNA classification needs case-level review

MT-CYB:m.15436C>A (p.Leu230=)

Tutor Research

Nomenclaturem.15436C>Ap.Leu230=chrMT:15436|Not in ClinVar

TypeSynonymous

InheritanceMitochondrial

gnomAD mtDNA

11 hom · 0 het

of 56,432 genomes

Tutor Research

MITOMAPReported

Live entry

Disease: Possible role in high altitude sicknessGenBank: 3 sequences

MITOMAP (mitomap.org), CC BY 3.0 · disease table as of 2026-10-07

Where it sits in the mitochondrial genome

Tap or hover a gene, landmark or tick; genes open their page, ticks their variant.

proteinrRNAtRNAouter ring H-strand · inner L-strandMITOMAP confirmedreported (as of 2026-10-07)

||||

TACACAATCAAAGACGCCCTCGGCTTACTTCTCTTCCTTCT

MT-CYB

m.15416–15456 of the revised Cambridge Reference Sequence (NC_012920.1); the boxed base is m.15436 C→A.

37 genes from Ensembl (rCRS numbering, matched to MITOMAP’s Gene Loci); landmarks and disease alleles from MITOMAP (CC BY 3.0). Circular layout after MitoWheel.

Open Research Assistant for MT-CYB →

External Resources

Franklin (Genoox)

AI-powered curation

MITOMAP

mtDNA variant database · expect a security check

VarSome

Variant interpretation · expect a security check

OMIM

Gene & phenotype

gnomAD

mtDNA frequencies (v3.1)

UCSC Browser

Genome browser

m.15436C>A

Resolving variant against ClinVar, gnomAD and Ensembl…

MT-CYB:m.15436C>A (p.Leu230=)

Where it sits in the mitochondrial genome

Lollipop Plot — Protein Context & Regional Constraint

Population Allele Frequencies

Mechanism of Pathogenicity

External Resources

MT-CYB:m.15436C>A (p.Leu230=)

Where it sits in the mitochondrial genome

Lollipop Plot — Protein Context & Regional Constraint

Population Allele Frequencies

Mechanism of Pathogenicity

External Resources