MT-RNR1:m.1555A>G

Tutor Research

Nomenclaturem.1555A>GchrMT:1555|ClinVar #9628

Typemitochondrial rRNA variant

InheritanceMitochondrial

gnomAD mtDNA

63 hom · 11 het

of 56,401 genomes

Avoid aminoglycoside antibiotics — risk of permanent hearing loss

Avoid aminoglycoside antibiotics unless the high risk of permanent hearing loss is outweighed by the severity of infection and there is no safe or effective alternative. CPIC: strong recommendation, high evidence.

Profound hearing loss has followed a single standard dose. Any heteroplasmy level counts — there is no safe threshold. Covers gentamicin, tobramycin, amikacin and the rest of the class.

CPIC guideline, McDermott et al. 2022 (PMID 34032273)

Tutor Research

ClinVarPathogenic

VCV000009628

Review: reviewed by expert panelSubmitters: 28view ↗Last evaluated: 2022/12/15 00:00

Mitochondrial disease[MedGen][Orphanet][MONDO]

kanamycin response - Toxicity

streptomycin response - Toxicity

tobramycin response - Toxicity

gentamicin response - Toxicity

amikacin response - Toxicity

aminoglycoside antibacterials response - Toxicity

MITOMAPPathogenicconfirmed

Live entry

Disease: Maternally inherited or aminoglycoside-induced deafness (DEAF) · Autism spectrum intellectual disability · Possibly antiatheroscleroticReported as: homoplasmic and heteroplasmicGenBank: 92 sequences

MITOMAP (mitomap.org), CC BY 3.0 · disease table as of 2026-10-07

Where it sits in the mitochondrial genome

Tap or hover a gene, landmark or tick; genes open their page, ticks their variant.

proteinrRNAtRNAouter ring H-strand · inner L-strandMITOMAP confirmedreported (as of 2026-10-07)

||||

TACGCATTTATATAGAGGAGACAAGTCGTAACATGGTAAGT

MT-RNR1

m.1535–1575 of the revised Cambridge Reference Sequence (NC_012920.1); the boxed base is m.1555 A→G.

37 genes from Ensembl (rCRS numbering, matched to MITOMAP’s Gene Loci); landmarks and disease alleles from MITOMAP (CC BY 3.0). Circular layout after MitoWheel.