Viewing single variant in CYTB

Uncertain Significance (VUS)Not in ClinVar or MITOMAP — mtDNA classification needs case-level review

CYTB:m.15954A>G

Tutor Research

Nomenclaturem.15954A>GchrMT:15954|Not in ClinVar

Typemitochondrial control region variant

gnomAD mtDNA

35 hom · 1 het

of 56,431 genomes

Tutor Research

MITOMAPReported

Live entry

Disease: Maternally inherited diabetes mellitus (DM)2Reported as: homoplasmic and heteroplasmicGenBank: 92 sequences

MITOMAP (mitomap.org), CC BY 3.0 · disease table as of 2026-10-07

Where it sits in the mitochondrial genome

Tap or hover a gene, landmark or tick; genes open their page, ticks their variant.

proteinrRNAtRNAouter ring H-strand · inner L-strandMITOMAP confirmedreported (as of 2026-10-07)

||||

AAAACCTTTTTCCAAGGACAAATCAGAGAAAAAGTCTTTAA

MT-TT · ends m.15953

MT-TP (L-strand) · starts m.15956

m.15934–15974 of the revised Cambridge Reference Sequence (NC_012920.1); the boxed base is m.15954 A→G.

37 genes from Ensembl (rCRS numbering, matched to MITOMAP’s Gene Loci); landmarks and disease alleles from MITOMAP (CC BY 3.0). Circular layout after MitoWheel.

Open Research Assistant for CYTB →

External Resources

Franklin (Genoox)

AI-powered curation

MITOMAP

mtDNA variant database · expect a security check

VarSome

Variant interpretation · expect a security check

OMIM

Gene & phenotype

gnomAD

mtDNA frequencies (v3.1)

UCSC Browser

Genome browser

m.15954A>G

Resolving variant against ClinVar, gnomAD and Ensembl…

CYTB:m.15954A>G

Where it sits in the mitochondrial genome

Lollipop Plot — Protein Context & Regional Constraint

Population Allele Frequencies

External Resources

CYTB:m.15954A>G

Where it sits in the mitochondrial genome

Lollipop Plot — Protein Context & Regional Constraint

Population Allele Frequencies

External Resources