m.15928G>A

Resolving variant against ClinVar, gnomAD and Ensembl…

Viewing single variant in MT-TT

Full MT-TT gene page

Benign / Likely Benign

MT-TT:m.15928G>A

Nomenclaturem.15928G>AchrMT:15928|ClinVar #143903

Typemitochondrial tRNA variant

InheritanceMitochondrial

gnomAD mtDNA

3,164 hom · 7 het

of 56,407 genomes

MitoTIP

7.5 · Q4 likely benign

PON-mt-tRNA

0.19 · neutral

ClinVarBenign/Likely benign

Review: criteria provided, multiple submitters, no conflictsSubmitters: 3view ↗Last evaluated: 2025/02/16 00:00

not specified[MedGen]

MELAS syndrome[OMIM][MedGen][Orphanet][MONDO]

MITOMAPReported

Disease: Multiple Sclerosis · Idiopathic repeat miscarriage · Alzheimer disease (AD) protectionReported as: homoplasmic and heteroplasmicGenBank: 3,320 sequences

MITOMAP (mitomap.org), CC BY 3.0 · disease table as of 2026-10-07

Where it sits in the mitochondrial genome

Tap or hover a gene, landmark or tick; genes open their page, ticks their variant.

proteinrRNAtRNAouter ring H-strand · inner L-strandMITOMAP confirmedreported (as of 2026-10-07)

||||

TACACCAGTCTTGTAAACCGGAGATGAAAACCTTTTTCCAA

A

MT-TT

m.15908–15948 of the revised Cambridge Reference Sequence (NC_012920.1); the boxed base is m.15928 G→A.

37 genes from Ensembl (rCRS numbering, matched to MITOMAP’s Gene Loci); landmarks and disease alleles from MITOMAP (CC BY 3.0). Circular layout after MitoWheel.

Open Research Assistant for MT-TT →

External Resources

Franklin (Genoox)

AI-powered curation

mtDNA variant database · expect a security check

Variant interpretation · expect a security check

Gene & phenotype

mtDNA frequencies (v3.1)