MT-TT:m.15950G>A

Tutor Research

Nomenclaturem.15950G>AchrMT:15950|ClinVar #9559

Typemitochondrial tRNA variant

InheritanceMitochondrial

gnomAD mtDNA

3 hom · 0 het

of 56,430 genomes

MitoTIP

12.9 · Q2 possibly pathogenic

PON-mt-tRNA

0.23 · neutral

Tutor Research

ClinVarUncertain significance

VCV000009559

Review: criteria provided, single submitterSubmitters: 2view ↗Last evaluated: 2019/07/12 00:00

MELAS syndrome[OMIM][MedGen][Orphanet][MONDO]

MITOMAPReported

Live entry

Disease: Leber hereditary optic neuropathy (LHON) · Leber hereditary optic neuropathy (LHON)-multiple sclerosis (MS) · Dopaminergic nerve cell death (Parkinson disease (PD))

+1 more

· Tic disorder

Reported as: homoplasmic and heteroplasmicGenBank: 4 sequences

MITOMAP (mitomap.org), CC BY 3.0 · disease table as of 2026-10-07

Where it sits in the mitochondrial genome

Tap or hover a gene, landmark or tick; genes open their page, ticks their variant.

proteinrRNAtRNAouter ring H-strand · inner L-strandMITOMAP confirmedreported (as of 2026-10-07)

|||||

GATGAAAACCTTTTTCCAAGGACAAATCAGAGAAAAAGTCT

MT-TT · ends m.15953

MT-TP (L-strand) · starts m.15956

m.15930–15970 of the revised Cambridge Reference Sequence (NC_012920.1); the boxed base is m.15950 G→A.

37 genes from Ensembl (rCRS numbering, matched to MITOMAP’s Gene Loci); landmarks and disease alleles from MITOMAP (CC BY 3.0). Circular layout after MitoWheel.