Viewing single variant in MT-CYB

Uncertain Significance (VUS)Not in ClinVar or MITOMAP — mtDNA classification needs case-level review

MT-CYB:m.15168G>A (p.Trp141Ter)

Tutor Research

Nomenclaturem.15168G>Ap.Trp141TerchrMT:15168|Not in ClinVar

TypeNonsense

InheritanceMitochondrial

gnomAD mtDNA

—

not loaded

Tutor Research

Some data sources returned errors (1) — other data may still be shown below

gnomad: gnomAD lookup failed: Error: gnomAD API error: 429

MITOMAPReported

Live entry

Disease: Exercise intolerance (EXIT)Reported as: heteroplasmicGenBank: 0 sequences

MITOMAP (mitomap.org), CC BY 3.0 · disease table as of 2026-10-07

Where it sits in the mitochondrial genome

Tap or hover a gene, landmark or tick; genes open their page, ticks their variant.

proteinrRNAtRNAouter ring H-strand · inner L-strandMITOMAP confirmedreported (as of 2026-10-07)

||||

GTGAGGCCAAATATCATTCTGAGGGGCCACAGTAATTACAA

MT-CYB

m.15148–15188 of the revised Cambridge Reference Sequence (NC_012920.1); the boxed base is m.15168 G→A.

37 genes from Ensembl (rCRS numbering, matched to MITOMAP’s Gene Loci); landmarks and disease alleles from MITOMAP (CC BY 3.0). Circular layout after MitoWheel.

Open Research Assistant for MT-CYB →

External Resources

Franklin (Genoox)

AI-powered curation

MITOMAP

mtDNA variant database · expect a security check

VarSome

Variant interpretation · expect a security check

OMIM

Gene & phenotype

gnomAD

mtDNA frequencies (v3.1)

UCSC Browser

Genome browser

m.15168G>A

Resolving variant against ClinVar, gnomAD and Ensembl…

MT-CYB:m.15168G>A (p.Trp141Ter)

Where it sits in the mitochondrial genome

Lollipop Plot — Protein Context & Regional Constraint

Population Allele Frequencies

Mechanism of Pathogenicity

External Resources

MT-CYB:m.15168G>A (p.Trp141Ter)

Where it sits in the mitochondrial genome

Lollipop Plot — Protein Context & Regional Constraint

Population Allele Frequencies

Mechanism of Pathogenicity

External Resources