m.3250T>C

Resolving variant against ClinVar, gnomAD and Ensembl…

Viewing single variant in MT-TL1

Full MT-TL1 gene page

Uncertain Significance (VUS)

MT-TL1:m.3250T>C

Nomenclaturem.3250T>CchrMT:3250|ClinVar #9593

Typemitochondrial tRNA variant

InheritanceMitochondrial

gnomAD mtDNA

0 hom · 3 het

of 56,429 genomes

MitoTIP

10.3 · Q3 possibly benign

PON-mt-tRNA

0.10 · neutral

ClinVarUncertain significance

Review: criteria provided, single submitterSubmitters: 2view ↗Last evaluated: 2019/07/12 00:00

MELAS syndrome[OMIM][MedGen][Orphanet][MONDO]

MITOMAPReported

Disease: Mitochondrial myopathy (MM) · Chronic progressive external ophthalmoplegia (CPEO) · CardiomyopathyReported as: heteroplasmicGenBank: 1 sequence

MITOMAP (mitomap.org), CC BY 3.0 · disease table as of 2026-10-07

Where it sits in the mitochondrial genome

Tap or hover a gene, landmark or tick; genes open their page, ticks their variant.

proteinrRNAtRNAouter ring H-strand · inner L-strandMITOMAP confirmedreported (as of 2026-10-07)

|||||

GTTAAGATGGCAGAGCCCGGTAATCGCATAAAACTTAAAAC

C

MT-TL1 · starts m.3230

m.3230–3270 of the revised Cambridge Reference Sequence (NC_012920.1); the boxed base is m.3250 T→C.

37 genes from Ensembl (rCRS numbering, matched to MITOMAP’s Gene Loci); landmarks and disease alleles from MITOMAP (CC BY 3.0). Circular layout after MitoWheel.

Open Research Assistant for MT-TL1 →

External Resources

Franklin (Genoox)

AI-powered curation

mtDNA variant database · expect a security check

Variant interpretation · expect a security check

Gene & phenotype

mtDNA frequencies (v3.1)